Objective

  • Understand the concept of custom functions and modules in Python.
  • Learn how to create custom functions and modules for bioinformatics tasks.
  • Explore examples of creating and using custom functions and modules in practical scenarios.

Introduction to Custom Functions

  • Custom functions are user-defined functions that perform specific tasks and can be reused throughout a program.
  • Benefits of custom functions:
    • Encapsulate reusable code into a single function.
    • Promote code modularity, readability, and maintainability.
    • Enable code reuse and reduce duplication.

Creating Custom Functions

  • To create a custom function in Python, use the def keyword followed by the function name and parameter list.
  • Function syntax:
def function_name(parameter1, parameter2, ...):
    # Code block
    # Perform task
    return result
  • Parameters: Input values passed to the function.
  • Code block: Contains the logic and operations to perform the desired task.
  • Return statement: Returns the result or output of the function.

Example: Creating a Custom Function

def calculate_gc_content(sequence):
    gc_count = sequence.count("G") + sequence.count("C")
    total_count = len(sequence)
    gc_content = (gc_count / total_count) * 100
    return gc_content

# Usage
dna_sequence = "AGCTAGCTGACTGACGTACG"
gc_content = calculate_gc_content(dna_sequence)
print("GC Content:", gc_content)
  • The calculate_gc_content() function takes a DNA sequence as input and calculates the GC content.
  • The function encapsulates the code logic for GC content calculation.
  • The GC content is returned as a percentage.

Introduction to Custom Modules

  • Custom modules are Python files containing reusable code that can be imported and used in other programs.
  • Modules allow you to organize related functions and classes into separate files for better code management.

Creating Custom Modules

  • To create a custom module, create a new Python file with a .py extension and define your functions or classes in that file.
  • Example custom module structure:
# custom_module.py

def function1():
    # Code block for function1
    pass

def function2():
    # Code block for function2
    pass

class MyClass:
    # Code block for MyClass
    pass
  • Save the file as custom_module.py.

Using Custom Modules

  • To use functions or classes from a custom module, import the module in your program using the import statement.
  • Example usage of a custom module:
import custom_module

custom_module.function1()
custom_module.function2()

my_object = custom_module.MyClass()

Summary

  • Custom functions and modules are essential for code organization, reusability, and modularity.
  • Custom functions encapsulate code logic and enable code reuse within a program.
  • Custom modules group related functions and classes into separate files for better code management