DNA probes and genetic fingerprinting
August 28, 2022 2022-08-28 17:07DNA probes and genetic fingerprinting
DNA probes and DNA hybridisation
- DNA probes are used to locate specific alleles of genes
- This can be used to see if a person has an allele that could lead to them having a genetic disorder
- DNA probes are short strands of DNA that have a complementary base sequence to the target allele
- They also have a fluorescent or radioactive label attached which means they can be seen under UV light or in an X-ray
- If they meed the target allele, they bind (hybridise) with it
- A sample of DNA is digested into fragments using restriction enzymes and separated through a process known as electrophoresis
- Electrophoresis is discussed in detail later in this section
- The separated DNA fragments are then transferred to a thin nylon membrane and the fluorescently – labelled DNA probe is added
- If the allele is present, the DNA probe will bind to it
- The membrane is then exposed to UV light and if the allele is present, a fluorescent band will appear
- DNA probes can also be used in DNA microarrays
- A microarray is a glass slide with different DNA probes attached to it
- When using a microarray, the DNA probes are not labelled; the human DNA that is added is
- The human DNA binds to any of the DNA probes that are complementary
- When the tray is rinsed and looked at under UV light, only certain spots on the microarray will light up. This indicates which alleles are present.
- DNA probes can be used to screen for:
- Inherited conditions such as Huntingdon’s disease. This disease does not have any effects until around age 40 so screening for it can allow a person to start the treatments as soon as possible
- Responses to specific drugs such as cancer medications that will only be effective if a person has a specific mutation in an allele
- Health risks such as genetic predispositions to developing certain cancers. This can allow people to make lifestyle choices that reduce their risk.
- This screening can be used in genetic counselling
Genetic fingerprinting
- Some of the non-coding DNA of an organism is made up of Variable Number Tandem Repeats (VNTRs)
- They are long chains of repeating base sequences eg ATGCATGCATGCATGCATGC…
- The number of repeats varies between individuals and can be compared
- This is known as genetic fingerprinting
Gel electrophoresis is used to separate DNA fragments to make a genetic fingerprint
- A DNA sample is obtained and the areas containing VNTRs are amplified using PCR
- DNA fragments corresponding to the length of the VNTRs are obtained and a fluorescent tag is added
- The DNA mixture is placed in a slab of gel and is covered with a buffer solution that conducts electricity
- An electrical current is passed through the gel
- DNA is negatively charged so the fragments move towards the positive electrode
- Smaller, more charged DNA fragments move further than heavier, less charged ones
- The electrical current is turned off and the DNA is transferred to a thin nylon membrane in a process known as Southern Blotting
- Under UV light, bands of DNA can be seen which is the individual’s genetic fingerprint
- Two genetic fingerprints can be compared and if both fingerprints have a band on the same location on the gel, it means they have the same number of VNTRs and are therefore related
- Genetic fingerprinting can be used in:
- Paternity tests, to determine who the father of a child is
- Forensic science, to compare suspects’ DNA with that found at the crime scene
- Medical diagnosis, to diagnose genetic disorders and cancer

Chuck Shupe
An excellent read that will keep readers – particularly me – coming back for more! Also, I’d genuinely appreciate if you check my website YK3 about Cosmetic Treatment. Thank you and best of luck!