DNA probes and genetic fingerprinting

DNA probes and DNA hybridisation

  • DNA probes are used to locate specific alleles of genes
    • This can be used to see if a person has an allele that could lead to them having a genetic disorder
  • DNA probes are short strands of DNA that have a complementary base sequence to the target allele
    • They also have a fluorescent or radioactive label attached which means they can be seen under UV light or in an X-ray
    • If they meed the target allele, they bind (hybridise) with it
  1. A sample of DNA is digested into fragments using restriction enzymes and separated through a process known as electrophoresis
    1. Electrophoresis is discussed in detail later in this section
  2. The separated DNA fragments are then transferred to a thin nylon membrane and the fluorescently – labelled DNA probe is added
  3. If the allele is present, the DNA probe will bind to it
  4. The membrane is then exposed to UV light and if the allele is present, a fluorescent band will appear
  • DNA probes can also be used in DNA microarrays
    • A microarray is a glass slide with different DNA probes attached to it
    • When using a microarray, the DNA probes are not labelled; the human DNA that is added is
    • The human DNA binds to any of the DNA probes that are complementary
    • When the tray is rinsed and looked at under UV light, only certain spots on the microarray will light up. This indicates which alleles are present.
  • DNA probes can be used to screen for:
    • Inherited conditions such as Huntingdon’s disease. This disease does not have any effects until around age 40 so screening for it can allow a person to start the treatments as soon as possible
    • Responses to specific drugs such as cancer medications that will only be effective if a person has a specific mutation in an allele
    • Health risks such as genetic predispositions to developing certain cancers. This can allow people to make lifestyle choices that reduce their risk.
  • This screening can be used in genetic counselling

Genetic fingerprinting

  • Some of the non-coding DNA of an organism is made up of Variable Number Tandem Repeats (VNTRs)
    • They are long chains of repeating base sequences eg ATGCATGCATGCATGCATGC…
    • The number of repeats varies between individuals and can be compared
    • This is known as genetic fingerprinting

Gel electrophoresis is used to separate DNA fragments to make a genetic fingerprint

  1. A DNA sample is obtained and the areas containing VNTRs are amplified using PCR
  2. DNA fragments corresponding to the length of the VNTRs are obtained and a fluorescent tag is added
  3. The DNA mixture is placed in a slab of gel and is covered with a buffer solution that conducts electricity
  4. An electrical current is passed through the gel
  5. DNA is negatively charged so the fragments move towards the positive electrode
  6. Smaller, more charged DNA fragments move further than heavier, less charged ones
  7. The electrical current is turned off and the DNA is transferred to a thin nylon membrane in a process known as Southern Blotting
  8. Under UV light, bands of DNA can be seen which is the individual’s genetic fingerprint
  9. Two genetic fingerprints can be compared and if both fingerprints have a band on the same location on the gel, it means they have the same number of VNTRs and are therefore related
  • Genetic fingerprinting can be used in:
    • Paternity tests, to determine who the father of a child is
    • Forensic science, to compare suspects’ DNA with that found at the crime scene
    • Medical diagnosis, to diagnose genetic disorders and cancer

Comment (1)

  1. An excellent read that will keep readers – particularly me – coming back for more! Also, I’d genuinely appreciate if you check my website YK3 about Cosmetic Treatment. Thank you and best of luck!

Leave your thought here

Your email address will not be published. Required fields are marked *

Alert: You are not allowed to copy content or view source !!